Alternative yeast nuclear code
Nuclear genetic code in some yeasts
From Wikipedia, the free encyclopedia
The alternative yeast nuclear code (translation table 12) is a genetic code found in certain yeasts. However, other yeast, including Saccharomyces cerevisiae, Candida azyma, Candida diversa, Candida magnoliae, Candida rugopelliculosa, Yarrowia lipolytica, and Zygoascus hellenicus, definitely use the standard (nuclear) code.[1]
The code
AAs = FFLLSSSSYY**CC*WLLLSPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -------------------M---------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (12) | Standard code (1) | |
|---|---|---|---|---|
CTG | CUG | Ser (S) | Leu (L) |
Alternative initiation codons
- CAG may be used in Candida albicans.[2]
Systematic range
- Endomycetales (yeasts): Candida albicans, Candida cylindracea, Candida melibiosica, Candida parapsilosis, and Candida rugosa.[1]
