Peritrich nuclear code
Nuclear genetic code in some ciliates
From Wikipedia, the free encyclopedia
The peritrich nuclear code (translation table 30) is a genetic code used by the nuclear genome of the peritrich ciliates Vorticella and Opisthonecta.[1]
The code (30)
AAs = FFLLSSSSYYEECC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (30) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Glu (E) | Ter (*) | |
| TAG | UAG | Glu (E) | Ter (*) |
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.