Chlorophycean mitochondrial code

From Wikipedia, the free encyclopedia

The chlorophycean mitochondrial code (translation table 16) is a genetic code found in the mitochondria of Chlorophyceae.

   AAs = FFLLSSSSYY*LCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = -----------------------------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code

DNA codonsRNA codonsThis code (16)Standard code (1)
TAGUAGLeu (L)STOP = Ter (*)

Systematic range and comments

See also

References

Related Articles

Wikiwand AI