Ciliate, dasycladacean and hexamita nuclear code
Alternative genetic code
From Wikipedia, the free encyclopedia
The ciliate, dasycladacean and Hexamita nuclear code (translation table 6) is a genetic code used by certain ciliate, dasycladacean and Hexamita species.
The ciliate macronuclear code has not been determined completely. The codon UAA is known to code for Gln only in the Oxytrichidae.
The code
AAs = FFLLSSSSYYQQCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (6) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Gln (Q) | STOP = Ter (*) | |
| TAG | UAG | Gln (Q) | STOP = Ter (*) |
Systematic range
- Ciliata: Oxytricha and Stylonychia,[1] Paramecium, Tetrahymena, Oxytrichidae and probably Glaucoma chattoni.
- Dasycladaceae: Acetabularia,[2] and Batophora.[3]
- Diplomonadida: Hexamita inflata, Diplomonadida ATCC50330, and ATCC50380.
