Listeria monocytogenes non-coding RNA

From Wikipedia, the free encyclopedia

Listeria snRNA rli22
Predicted secondary structure of Listeria snRNA rli22
Identifiers
Symbolrli22
RfamRF01457
Other data
RNA typegene, snRNA
DomainListeria
PDB structuresPDBe

Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis.[1]

Tiling arrays and mutagenesis identified many non-coding RNAs within the L. monocytogenes genome and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as cis-regulatory elements. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis.[2] The tables below summarizes the location, flanking genes and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes

ID Start Stop Size 5′ flanking gene sense of the gene on the genome a 3′ flanking gene Characteristic Rfam
rli22 31997 32107 110 lmo0028 -> -> -> lmo0029 sRNA
rli23 172171 172268 97 lmo0172 <- -> sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35.
rli24 271029 271186 157 lmo0256 -> -> -> lmo0257 sRNA
rli25 357618 357516 102 lmo0330 -> <- sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35
rli26 388707 388520 187 lmo0360 -> <- <- lmo0361 sRNA
rli27 434831 434929 98 lmo0411 <- -> <- lmo0412 sRNA
rli28 507394 507206 188 lmo0470 -> <- -> lmo0471 sRNA Homolog of rli50
rli29 507643 507450 193 lmo0470 -> <- -> lmo0471 sRNA Antisense to the 5'UTR of lmo0471
rli30 540785 540670 115 lmo0506 -> <- sRNA Antisense to lmo0506
rli31 597812 597926 114 lmo0558 <- -> -> lmo0559 Required for lysozyme resistance and pathogenesis.[3] Structure characterized as two long hairpins. Interacts with the RNA binding global regulator SpoVG.[4]
rli32 600750 600604 147 lmo0560 <- <- <- lmo0561 sRNA
rli33 708326 708860 534 lmo0671 -> -> -> lmo0672 sRNA
rli34 803031 802948 83 lmo0777 -> <- -> lmo0778 sRNA
rli35 855495 855393 102 lmo0828 -> <- sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25
rli36 859527 859444 83 nifJ -> <- <- fbp sRNA
rli37 907576 907832 256 lmo0866 -> -> -> lmo0867 ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG
rli38 1152549 1152917 369 lmo1115 <- -> -> lmo1116 sRNA role in virulence
rli39 1179807 1179993 187 lmo1149 -> -> <- lmo1150 sRNA Annotated as a cobalamin riboswitch in Rfam
rli40 1275810 1275547 264 lmo1251 -> <- <- lmo1252 ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG
rli41 1277207 1276713 495 lmo1252 <- <- -> lmo1253 Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG
rli42 1399617 1399447 171 lmo1374 -> <- -> lmo1375 sRNA
rli43 1861630 1861377 253 inlC <- <- <- rplS ORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG
rli44 2039087 2039375 289 lmo1964 <- -> <- lmo1965 ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG
rli45 2154775 2154852 77 lmo2074 -> -> <- lmo2075 sRNA Antisense to rli46
rli46 2155058 2154765 294 lmo2074 -> <- <- lmo2075 sRNA Antisense to rli45
rli47 2226024 2226532 508 lmo2141 -> -> <- lmo2142 sRNA
rli48 2361423 2361274 149 lmo2271 <- <- -> lmo2272 sRNA
rli49 2660179 2660364 185 lmo2579 -> -> <- lmo2580 sRNA
rli50 2783274 2783098 176 lmo2709 -> <- <- lmo2710 sRNA Homolog of rli28
rli51 207589 207709 120 hly -> -> -> mpl 5′-UTR-derived Increased in intestinal lumen
rli52 552421 552327 94 lmo0517 <- <- <- lmo0518 5′-UTR-derived Putative riboswitch.
rli53 955829 956001 172 lmo0918 -> -> -> lmo0919 5′-UTR-derived Putative riboswitch.
rli54 1078584 1079111 527 lmo1051 <- -> -> pdhA 5′-UTR-derived Putative riboswitch.
rli55 1198107 1198389 282 lmo1170 -> -> -> pduQ 5′-UTR-derived Putative riboswitch.
rli56 1199859 1199958 99 pduQ -> -> -> lmo1172 5′-UTR-derived Putative riboswitch.
rli57 ? 1216658 ? lmo1190 -> -> -> cbiA 3′-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen
rli58 ? 1639974 ? rpsD -> <- <- lmo1597
rli59 1702553 1702373 180 lmo1652 <- <- <- lmo1653 5′-UTR-derived
rli60 2054124 2054308 184 lmo1982 <- -> -> ilvD 5′-UTR-derived Putative riboswitch.
rli61 2275363 2275258 106 lmo2187 <- <- <- lmo2188 5′-UTR-derived Putative riboswitch
rli62 2364508 2364337 172 lmo2277 <- <- <- lmo2278 5′-UTR-derived Putative riboswitch.
rli63 2613301 ? ? atpI <- <- <- lmo2537 5′-UTR-derived Putative riboswitch
rliA 513584 513807 224 lmo0476 <- >- >- lmo0477 snRNA
rliB 544357 544716 360 lmo0509 -> -> -> lmo0510 sRNA
rliC 1154309 1154671 363 lmo1117 -> -> <- lmo1118 sRNA
rliD 1359529 1359202 328 rpsO -> <- -> pnpA sRNA antisense
rliE 1584586 1584808 223 comC <- -> <- folC sRNA antisense to comC mRNA
rliF 2106292 2106073 220 nadA -> <- <- lmo2026 snRNA
rliG 2386992 2386715 278 lmo2302 <- <- <- lmo2303 sRNA
rliH 1180826 1181254 429 lmo1150 <- -> -> lmo1151 sRNA antisense
rliI 2842200 2841962 239 lmo2760 <- <- -> lmo2761 sRNA
sbrA[5] 1399363 1399433 70 lmo1374 -> -> -> lmo1375 sRNA

aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.

Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1

Characterised non-coding RNAs

References

Related Articles

Wikiwand AI