Pachysolen tannophilus nuclear code

From Wikipedia, the free encyclopedia

The pachysolen tannophilus nuclear code (translation table 26) is a genetic code found in the ascomycete fungus Pachysolen tannophilus.[1]

   AAs = FFLLSSSSYY**CC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = -------------------M---------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code

DNA codonsRNA codonsThis code (26)Standard code (1)
CTGCUGAla (A)Leu (L)

Initiation codons

This code uses the initiation codons AUG, GUG and UUG.

Systematic range and comments

See also

References

Related Articles

Wikiwand AI