Thraustochytrium mitochondrial code
From Wikipedia, the free encyclopedia
The Thraustochytrium mitochondrial code (translation table 23) is a genetic code found in the mitochondria of the labyrinthulid protist Thraustochytrium aureum.[1] The mitochondrial genome was sequenced by the Organelle Genome Megasequencing Program.
AAs = FF*LSSSSYY**CC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------------------------M--M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
It is the similar to the bacterial code (translation table 11) but it contains an additional stop codon (TTA) and also has a different set of start codons.
| DNA codons | RNA codons | This code (23) | Standard code (1) | |
|---|---|---|---|---|
TTA | UUA | STOP = Ter (*) | Leu (L) |
Systematic range and comments
- Mitochondria of Thraustochytrium aureum.
