Yeast mitochondrial code

Mitochondrial genetic code in yeasts From Wikipedia, the free encyclopedia

The yeast mitochondrial code (translation table 3) is a genetic code used by the mitochondrial genome of yeasts, notably Saccharomyces cerevisiae, Candida glabrata, Hansenula saturnus, and Kluyveromyces thermotolerans.[1]

The code

   AAs = FFLLSSSSYY**CCWWTTTTPPPPHHQQRRRRIIMMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = ---M---------------M---------------M---------------M------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).

Differences from the standard code

More information DNA codons, RNA codons ...
DNA codonsRNA codonsThis code (3)Standard code (1)
ATAAUAMet (M)Ile (I)
CTTCUUThr (T)Leu (L)
CTCCUCThr (T)Leu (L)
CTACUAThr (T)Leu (L)
CTGCUGThr (T)Leu (L)
TGAUGATrp (W)STOP = Ter (*)
CGACGAAbsentArg (R)
CGCCGCAbsentArg (R)
Close

See also

References

Related Articles

Wikiwand AI